Home | China Stories | Amusing
26 August 2007

The Return of the Ghost of the Third Reich for Initiating the Third World War
The Coming War with Humans
- for our devine rights of dectating the earth

Pro. Nazirro: Buddies, for a less crowded planet and a single polar world, let’s beleaguer the 1.3 billion yellow-skined men and women with both internal and external threats! Tell you what, I'm determined with my final solution: If the Japanese don't get them, AIDS and SARS will!

Let's Cut Her into Seven Pieces

26 August 2007

A Japanese Iron Chef-would-be cuts the human-shaped cake

Wow, red blood, so beautiful, so tempting!

The photo was allegedly taken at a Japanese dinner party in which a giant cake was presented in a vivid and detailed shape of an attractive young woman.

Made-in-USA?

Recently, there are a lot of clamours from the American politicians and media guys for the things Made-in-China. On the other hand, there are also some noises from the China's Angry Youth (fenqing 愤青) about the things Made-in-USA.

To start with, some young and curious fellas in China are no less obsessed with conspiracy theories than many young and mid-aged and aging folks in America's media and other professional fields. So as it has happened, those young Chinese have asked poking or joking (depending on your viewpoint) questions regarding the true origin and peculiar nature of SARS:

"Have at any time in written memory we ever had a virus apart from SARS so mysterious that emerged without precedent and without hint, then disappeared without trace and without consequence?

"Have we ever seen in history a virus other than SARS that mainly affected people of certain ethnicity living in a country with a certain social system?"

The Severe acute respiratory syndrome (SARS) has been pinned down to a Coronavirus which contains a RNA sequence that does not have a direct association with any known human or animal germ cells. Over the years conspiracy fans in the West have already been probing the possibility of the common Coronavirus coat protein genes being manipulated in laboratory for the purpose of creating SARS viral vector to propagate foreign genes.

But some Chinese fenqings go much further, claiming the signature of the SARS virus creators has been discovered after decoding a seemingly useless Nucleotide sequence in the SARS genes:

GUUACUGAGGAUAAAGGUAAGAAAAUA

Transcribe the Nucleotide sequence into a RNA sequence, you get something like this:

GUU. ACU. GAG. GAU. AAA. GGU. AAG. AAA. AUA

Convert the RNA sequence to the binary numerical system, you get this:

A = 00
G = 01
U = 10
C = 11

Insert “1” into the numerical sequence, you get this:

011010. 001110. 010001. 010010. 000000. 010110. 000001. 000000. 001000

Convert the binary numerical system to the decimal numerical system, you get this:

26. 14. 17. 18. 0. 22. 1. 0. 8. 6. 14

Convert the numbers to English letters with “0” represented by a blank space, you get this:

ZNQR VA HFN

Decode ROT13 message, you get this:

MADE IN USA

Given the brilliant track record of the USA’s superior abilities for military weapons development, which is utterly unmatchable and unbeatable by any nations and blocs in the world, some Chinese youth thus ask a question, in a ultra solemn manner:

非典 - 天灾还是人祸?

Is SARS epidemic a natural disaster or man-made calamity?

Previous: How to Modernise th eWildness
Next: Chinese Netzen's Humour

All Amusings and Musings

Culture of China
Places in China
People in China
China at a Glance
Fengshui
Mysticism
Martial Arts
Chinese Dishes


Back to Top


Home | China Stories

Google
 

.

Copyright © 2005-2008 wenhousecrafts.com